View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19528_low_3 (Length: 492)
Name: NF19528_low_3
Description: NF19528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19528_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 459; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 459; E-Value: 0
Query Start/End: Original strand, 17 - 479
Target Start/End: Original strand, 7166134 - 7166596
Alignment:
| Q |
17 |
aagtttcacaatgtgatcatgtagatgggatccgcttaaaaccttggctggatccgcggtctttggctagtgccttacagaattggagacctgatgaggt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7166134 |
aagtttcacaatgtgatcatgtagatgggatccgcttaaaaccttggctggatccgcggtctttggctagtgccttacagaattggagtcctgatgaggt |
7166233 |
T |
|
| Q |
117 |
atcagcactagagggtgcaaattttgtgtggacaactaggttggtatgcaagatacttagaagtttcaggtcaccggatactgcgtggaatttcttctgc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7166234 |
atcagcactagagggtgcaaattttgtgtggacaactaggttggtatgcaagatacttagaagtttcaggtcaccggatactgcgtggaatttcttctgc |
7166333 |
T |
|
| Q |
217 |
tgggttgctgatcgacctggatttactcataatatatacacagtacaaagaatcatgacccttctagcgcgacatggacgtactgaattggttgatagac |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7166334 |
tgggttgctgatcgacctggatttactcataatatatacacagtacaaagaatcatgacccttctagcgcgacatggacgtactgaattggttgatagac |
7166433 |
T |
|
| Q |
317 |
tcatcttgaagatcagaatagagggaatgagactaccattcagtaccataaggttaatcattgacttttacgggatttcaaaaaatgctgatgctgctct |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7166434 |
tcatcttgaagatcagaatagagggaatgagactaccattcagtaccataaggttaatcattgacttttacgggatttcaaaaaatgctgatgctgctct |
7166533 |
T |
|
| Q |
417 |
gaaggttttcaacgatgatcaaatactttgtgggtctatatcgaaagttaacttgatgcttct |
479 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7166534 |
gaaggttttcaacgatgatcaaatactttgtgggtctatatcgaaagttaacttgatgcttct |
7166596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University