View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19529_high_17 (Length: 455)
Name: NF19529_high_17
Description: NF19529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19529_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 397; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 19 - 439
Target Start/End: Original strand, 20573227 - 20573647
Alignment:
| Q |
19 |
gagggagttgagtaggggacatgtagagagagaggggaaaaaagaacttgaaaaggtgagggaggaaatggctaggaatgagaacaaaagggaaaaggtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20573227 |
gagggagttgagtaggggacatgtagagagagaggggaaaaaagaacttgaaaaggtgagggaggaaatggctaggaatgagaacaaaagggaaaaggtg |
20573326 |
T |
 |
| Q |
119 |
atggaggttaaggtgagggtaaaccaaaaatggacataaataatgttattcagatgcatgacggaaaggagctcgttgtggaggtgaaaggatcgacgta |
218 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20573327 |
atggaggttaaggggagggtaaaccaaaaatggacataaataatgttattcagatgcatgacggaaaggagctcgttgtggaggtgaaaggatcgacgta |
20573426 |
T |
 |
| Q |
219 |
cgcagatttcgtggtgagaaataatatgaaagaaggacgtgggttgttaacatgtatttgaattcatgggtttggtggatagaaatgggttgccattgaa |
318 |
Q |
| |
|
|| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
20573427 |
cgtagatttcgtggtgagaaataataagaaagaaggacgtgggttgttaacatgtatttgaattcatgggtttggtggatagaaatgtgctgccattgaa |
20573526 |
T |
 |
| Q |
319 |
tgaagatattgtatgggctagtaaagggttcacatctaaaatctgcaatggcatctgtgttctagtgctccaacagtctattacaaatgctgattttacg |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20573527 |
tgaagatattgtatgggctagtaaagggttcacatcttaaatctgcaatggcatctgtgttctagtgctccaacagtctattacaaatgctgattttacg |
20573626 |
T |
 |
| Q |
419 |
gattttgtagttgttcccgtg |
439 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
20573627 |
gattttgtagttgttcccgtg |
20573647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University