View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19529_high_47 (Length: 237)
Name: NF19529_high_47
Description: NF19529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19529_high_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 10 - 114
Target Start/End: Original strand, 5497167 - 5497271
Alignment:
| Q |
10 |
ataatactagtgcacctctcaatacgtaaccaaaaagatgaaattataattgagtaatttttaagagtgggatgtctcgggtattcacaaagtggttagt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5497167 |
ataatactagtgcacctctcaatacgtaaccaaaaagatgaaattataattgagtaatttttaagagtgggatgtctcgggtattcacaaagtggttagt |
5497266 |
T |
 |
| Q |
110 |
tatta |
114 |
Q |
| |
|
||||| |
|
|
| T |
5497267 |
tatta |
5497271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University