View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19529_high_54 (Length: 209)
Name: NF19529_high_54
Description: NF19529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19529_high_54 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 31276095 - 31275887
Alignment:
| Q |
1 |
aatgtgctattaagtttcagtaattcttctcactgttcttttgttttctttctccttttactataggatgcattcaacttatgatttgatatacaaatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31276095 |
aatgtgctattaagtttcagtaattcttctcactgttcttttgttttctttctccttttactataggatgcattcaacttatgatttgatatacaaatgc |
31275996 |
T |
 |
| Q |
101 |
taatttaacttcgttcaaaagttcaaattgtggttgaatgatatagctttaccatgaaagagcttagtgaaattgatcttaactctctaaagaaattata |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31275995 |
taatttaacttggttcaaaagttcaaattgtggttgaatgatatagctttaccatgaaagagcttagtgaaattgatcttaactctctgaagaaattata |
31275896 |
T |
 |
| Q |
201 |
aaaatagct |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
31275895 |
aaaatagct |
31275887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University