View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19529_high_59 (Length: 206)
Name: NF19529_high_59
Description: NF19529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19529_high_59 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 95 - 198
Target Start/End: Original strand, 34581057 - 34581160
Alignment:
| Q |
95 |
tggatatatctcaattgaaaatggataagaataagggtagcttaccccatgggaggagtacgtccaagtccattttgcaacatataactcttaacattct |
194 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34581057 |
tggatatatctcaattaaaaatggataagaataagggtagcttaccccatgggaggagtacgtccaagtccattttgcaacatataactcttaacattct |
34581156 |
T |
 |
| Q |
195 |
tctc |
198 |
Q |
| |
|
|||| |
|
|
| T |
34581157 |
tctc |
34581160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 34580961 - 34581012
Alignment:
| Q |
1 |
accatacctgattttgtttcttaaaaatttaagacacgtatatgtgtgtgtt |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34580961 |
accatacctgattttgtttcttaaaaatttaagacacgtatatgtgtgtgtt |
34581012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 195
Target Start/End: Original strand, 35125063 - 35125121
Alignment:
| Q |
137 |
taccccatgggaggagtacgtccaagtccattttgcaacatataactcttaacattctt |
195 |
Q |
| |
|
|||||||||||||| || | |||||||||||||| |||| |||||||||||| ||||| |
|
|
| T |
35125063 |
taccccatgggaggtgtctgaccaagtccattttgtaacaaataactcttaaccttctt |
35125121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 137 - 188
Target Start/End: Original strand, 32602580 - 32602631
Alignment:
| Q |
137 |
taccccatgggaggagtacgtccaagtccattttgcaacatataactcttaa |
188 |
Q |
| |
|
|||||||||||||| || | ||||||||||||||||||||||||||||||| |
|
|
| T |
32602580 |
taccccatgggaggtgtctgaccaagtccattttgcaacatataactcttaa |
32602631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 137 - 185
Target Start/End: Original strand, 32592438 - 32592486
Alignment:
| Q |
137 |
taccccatgggaggagtacgtccaagtccattttgcaacatataactct |
185 |
Q |
| |
|
|||||||||||||| || | |||||||||||||||||||||||||||| |
|
|
| T |
32592438 |
taccccatgggaggtgtctgaccaagtccattttgcaacatataactct |
32592486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University