View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19529_low_22 (Length: 389)
Name: NF19529_low_22
Description: NF19529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19529_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 1e-54; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 260 - 380
Target Start/End: Original strand, 2291165 - 2291285
Alignment:
| Q |
260 |
cctttgaattcgtctttcttgtagactgctattcttttgtttgatgttttcctttaaacttgtttgcttacgcagtgcttctgttatatatgaattcata |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||||||||||||||||| |
|
|
| T |
2291165 |
cctttgaattcgtctttcttgtagactgctattcttttgtttgatgttttcctttaaacttgtttgcttacgtaatgcttttgttatatatgaattcata |
2291264 |
T |
|
| Q |
360 |
attttttatttatattcttct |
380 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2291265 |
attttttatttatattcttct |
2291285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 41 - 114
Target Start/End: Original strand, 2290921 - 2290994
Alignment:
| Q |
41 |
cttccttcttaactcttcatgtgtttttccttcttccctactgttttataaatacgaaatcaagaacacatatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
2290921 |
cttccttcttaactcttcatgtgtttttccttcttccctactgttttataaatacgaattcaataacacatatt |
2290994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 111 - 166
Target Start/End: Original strand, 2291020 - 2291075
Alignment:
| Q |
111 |
tattgtggattttatattgttacatctacatccaaggtcttggatagattgaaagg |
166 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2291020 |
tattttggattttatattgttacatctacatccaaggtcttggatagattgaaagg |
2291075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University