View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19529_low_40 (Length: 277)
Name: NF19529_low_40
Description: NF19529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19529_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 19 - 139
Target Start/End: Complemental strand, 38064313 - 38064193
Alignment:
| Q |
19 |
gtatcaccaagctcatgtatccttccaacaattttgatgaactttaaattgttggctcttgcaacgttatcttttgtatggtcgactgtaataactcttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
38064313 |
gtatcaccaagctcatgtatccttccaacaattttgatgaactttaaattgttggctcttgcaacggtatcttttgtatggtcgactgtaataacacttc |
38064214 |
T |
 |
| Q |
119 |
tgttttattatggaattggaa |
139 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38064213 |
tgttttattatggaattggaa |
38064193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 167 - 258
Target Start/End: Complemental strand, 38064193 - 38064102
Alignment:
| Q |
167 |
accgcttattgaaaagccaaaagtgaatttgaaaagaaattattccaaactaaattttttgtaaaattaaacaggaaatgacatatttattt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| ||||| ||||||||||||| |
|
|
| T |
38064193 |
accgcttattgaaaagccaaaagtgaatttgaaaagaaattattccaaactaaaatttttgtaaagttaaaccggaaacgacatatttattt |
38064102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University