View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19529_low_44 (Length: 247)
Name: NF19529_low_44
Description: NF19529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19529_low_44 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 6639224 - 6638988
Alignment:
| Q |
1 |
gatgccagtcaatcgaaatcgaaagattgggcgggtcgcggctgaggttgaaaccctatccaccccttcccattaatatattgttgatgttgattgttga |
100 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6639224 |
gatgccagtcaatcgaaacccaaagattgggcgg-tcgcggctgaggctgaaaccctatccaccccttcccattaatatattgttgatgttgattgttga |
6639126 |
T |
|
| Q |
101 |
tacgaagctctacaacttctcaaaggtttagattgctacctagtggtgcaccttatcaactgaaacatacacaaatgtaatggcttcttagcctctttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
6639125 |
tacgaagctctacaacttctcaaaggtttagattgccacctagtggtgcaccttatcaactgaaacatacacaaatgtattgacttcttagcctctttgg |
6639026 |
T |
|
| Q |
201 |
gtcataaggtcttgtttagtttctgctcttatgagtat |
238 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
6639025 |
gtcataagatcttgtttggtttctgctcttatgagtat |
6638988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University