View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19529_low_45 (Length: 241)
Name: NF19529_low_45
Description: NF19529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19529_low_45 |
 | |
|
| [»] scaffold0392 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0392 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: scaffold0392
Description:
Target: scaffold0392; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 11 - 241
Target Start/End: Original strand, 16045 - 16276
Alignment:
| Q |
11 |
taatactccctccaaacttaagtataagtaaaaagaagggtgggaaaacggagggacagttcagttttgatccgccccactattatccctaaaaaatggg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
16045 |
taatactccctccaaacttaagtataagtaaaaagaagggtgggaaaacggagggacggttcacttttgatccgctccatgattatccctaaaaaatggg |
16144 |
T |
|
| Q |
111 |
ataaagtcggccaatttaaatggacaagttgaaacttttaccttgtcccttagaggactgc-cgggacaaattgatccgtaaaagaaactttgtcattcg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| | ||||||||||| |||||||||||| ||||||| |||||| |||||||||| ||||||||||| |
|
|
| T |
16145 |
ataaagtcggccaatttaaatggacaagttaaaattcttaccttgtcctttagaggactgctggggacaagttgatctgtaaaagaaattttgtcattcg |
16244 |
T |
|
| Q |
210 |
catctcatgaaaatgataataatatcaacaat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
16245 |
catctcatgaaaatgataataatatcaacaat |
16276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University