View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19529_low_47 (Length: 237)

Name: NF19529_low_47
Description: NF19529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19529_low_47
NF19529_low_47
[»] chr5 (1 HSPs)
chr5 (10-114)||(5497167-5497271)


Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 10 - 114
Target Start/End: Original strand, 5497167 - 5497271
Alignment:
10 ataatactagtgcacctctcaatacgtaaccaaaaagatgaaattataattgagtaatttttaagagtgggatgtctcgggtattcacaaagtggttagt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5497167 ataatactagtgcacctctcaatacgtaaccaaaaagatgaaattataattgagtaatttttaagagtgggatgtctcgggtattcacaaagtggttagt 5497266  T
110 tatta 114  Q
    |||||    
5497267 tatta 5497271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University