View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19529_low_57 (Length: 207)
Name: NF19529_low_57
Description: NF19529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19529_low_57 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 73 - 192
Target Start/End: Complemental strand, 19631221 - 19631102
Alignment:
| Q |
73 |
catccaacaagacatcattattaacattagaagaatggaacggttcatctcccactaaactctccaaaactttcactatcaaagcttcttcttcctcttt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19631221 |
catccaacaagacatcattattaacattagaagaatggaacggttcatctcccactaaactctctaaaactttcactatcaaagcttcttcttcctcttt |
19631122 |
T |
 |
| Q |
173 |
ctccattcaaaggttcttct |
192 |
Q |
| |
|
|||||||| ||||||||||| |
|
|
| T |
19631121 |
ctccattcgaaggttcttct |
19631102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University