View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1952_high_42 (Length: 320)
Name: NF1952_high_42
Description: NF1952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1952_high_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 7 - 302
Target Start/End: Complemental strand, 8637507 - 8637212
Alignment:
| Q |
7 |
catcatcaatgagcatcaaactatccttcaacaaaacttgcagtttatacacaataacacaaacacatgttgctcatgaagtccaaagaaatgtattgaa |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8637507 |
catcatccatgagcatcaaactatccttcaacaaaacttgcagtttatacacaataacacaaacacatgttgctcatgaagtccaaagaaatgtattgaa |
8637408 |
T |
|
| Q |
107 |
ccgaaaagaattaacacaaatcagaatagttggtagtgatatnnnnnnncaaaagccnnnnnnngtgatgcgcataagctctgcaagcttgatttaacaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8637407 |
ccgaaaagaattaacacaaatcagaatagttggtagtgatataaaaaaacaaaagcctttttttgtgatgcgcataagctctgcaagcttgatttaacaa |
8637308 |
T |
|
| Q |
207 |
aagttcactgtaaatcaaataaaacaccttcctgctttgcatatttattacatcctcccaaaatccatataacataaccacaaacacggatgcatc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8637307 |
aagttcactgtaaatcaaataaaacaccttcctactttgcatatttattacatcctcccaaaatccatataacataaccacaaacacggattcatc |
8637212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University