View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1952_high_62 (Length: 235)
Name: NF1952_high_62
Description: NF1952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1952_high_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 7 - 162
Target Start/End: Complemental strand, 15719134 - 15718979
Alignment:
| Q |
7 |
ttttctcaccattggcgcaaccttcccctttttctttcatcatttgttggtagtggagagaagaaatatatgatattgctttaattatctcagtgtccca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
15719134 |
ttttctcaccattggcgcaaccttcccctttttctttcatcatttgttggtagtggtgagaagaaatatatgatatgaccttaattatctcagtgtccca |
15719035 |
T |
 |
| Q |
107 |
atggtaaccgtaacctctaccggttctttcatcatcatgatttccatgcttcaatt |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15719034 |
ttggtaaccgtaacctctaccggttctttcatcatcatgatttccatgcttcaatt |
15718979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 157 - 200
Target Start/End: Complemental strand, 32723995 - 32723952
Alignment:
| Q |
157 |
tcaattgtttgattctttgcggttagttttgtagtttttgggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32723995 |
tcaattgtttgattctttgcggttagttttgtagattttgggaa |
32723952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University