View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1952_high_62 (Length: 235)

Name: NF1952_high_62
Description: NF1952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1952_high_62
NF1952_high_62
[»] chr1 (1 HSPs)
chr1 (7-162)||(15718979-15719134)
[»] chr5 (1 HSPs)
chr5 (157-200)||(32723952-32723995)


Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 7 - 162
Target Start/End: Complemental strand, 15719134 - 15718979
Alignment:
7 ttttctcaccattggcgcaaccttcccctttttctttcatcatttgttggtagtggagagaagaaatatatgatattgctttaattatctcagtgtccca 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||  | ||||||||||||||||||||    
15719134 ttttctcaccattggcgcaaccttcccctttttctttcatcatttgttggtagtggtgagaagaaatatatgatatgaccttaattatctcagtgtccca 15719035  T
107 atggtaaccgtaacctctaccggttctttcatcatcatgatttccatgcttcaatt 162  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15719034 ttggtaaccgtaacctctaccggttctttcatcatcatgatttccatgcttcaatt 15718979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 157 - 200
Target Start/End: Complemental strand, 32723995 - 32723952
Alignment:
157 tcaattgtttgattctttgcggttagttttgtagtttttgggaa 200  Q
    |||||||||||||||||||||||||||||||||| |||||||||    
32723995 tcaattgtttgattctttgcggttagttttgtagattttgggaa 32723952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University