View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1952_low_29 (Length: 403)
Name: NF1952_low_29
Description: NF1952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1952_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 76 - 381
Target Start/End: Original strand, 50117630 - 50117923
Alignment:
| Q |
76 |
cagtcacatttaatgcttttggtcatcccctagatgagcagcacgtctgttgagtacattcctccctgacatcttttccgttctttaatttaatggaatc |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50117630 |
cagtcacatttaatgcttttggtcatcccctagatgagcagcacgtctgttgagtacattcctccctgacatcttttccgttctttaatttaatggaatc |
50117729 |
T |
|
| Q |
176 |
agtcatgcaaatctctgtggtatttcatgtggctatttgcagataaaattgactggattgctcgagtgggtgatgaaagccaaagcctggatttaattca |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50117730 |
agtcatgcaaatctctgtggtatttcatgtggctatttgcagataaaattgactggattgctcgagtgggtgatgaaagccaaagcctggatttaattca |
50117829 |
T |
|
| Q |
276 |
tctcagatggcgtacgttcagggttgagttcaaccctaaagaggtatgttatccgtcgatccagaaaacttattttgtttgttggtttcaataccgaaac |
375 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50117830 |
tctcagatggcgtac------------gttcaaccctaaagaggtatgttatccgtcgatccagaaaactgattttgtttgttggtttcaataccgaaac |
50117917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University