View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1952_low_34 (Length: 389)
Name: NF1952_low_34
Description: NF1952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1952_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-137; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 16 - 275
Target Start/End: Original strand, 14754711 - 14754970
Alignment:
| Q |
16 |
gtttcttcctttttctcttcttcaacaactatttccctctctttcacagcacttgtttcatcttctgtttttgtttctgtagtagctggtgcttcttcca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
14754711 |
gtttcttcctttttctcttcttcaacaactatttccctctctttcacaccacttgtttcatcttctgtttttgtttctgtagtagctggtgcttcttcaa |
14754810 |
T |
|
| Q |
116 |
ctttctcttctgtgactatgaaagttgataccttctcaaaaacaaagaaaactggacctgaaactaaggctggtccaaacttggatgatgcttcagatac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14754811 |
ctttctcttctgtgactatgaaagttgataccttctcaaaaacaaagaaaactggacctgaaactaaggctggtccaaacttggatgatgcttcagatac |
14754910 |
T |
|
| Q |
216 |
tgcttttgatccaggaaaatctgaaatatatatactcactagtatcaatatatttttctt |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14754911 |
tgcttttgatccaggaaaatctgaaatatatatactcacttgtatcaatatatttttctt |
14754970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 346 - 389
Target Start/End: Original strand, 14755041 - 14755084
Alignment:
| Q |
346 |
actttaccaattttaacaagttcttctatgaatttgtgaacttc |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14755041 |
actttaccaattttaacaagttcttctatgaatttgtgaacttc |
14755084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University