View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1952_low_48 (Length: 304)
Name: NF1952_low_48
Description: NF1952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1952_low_48 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 67 - 297
Target Start/End: Complemental strand, 11937695 - 11937466
Alignment:
| Q |
67 |
atgattgtgttctcgaacatggtaaattggggaaaaaggtcatggtttatgtgagcatatagcaccatcatcatcacttaaacatatgtcaattctggta |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11937695 |
atgattgtgttctcgaacatggtaaattggggaaaaaggtcatggtttatgtgagcatatagcaccatcatcatcacttaaacatatgtcaattctggta |
11937596 |
T |
|
| Q |
167 |
cgatttcaaatggatgaaaaagaagtatcaatattacacttaactcgaccgggttgaggttttttgccaccgatcatgccttattgctcttggttgtgct |
266 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11937595 |
cgatttcaaatggatgaaaaaaaagtatcaatattacacttaactcgaccgggttgaggt-ttttgccaccgatcatgccttattgctcttggttgtgct |
11937497 |
T |
|
| Q |
267 |
tgttgcatttgcgtgttgcctacatactctg |
297 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |
|
|
| T |
11937496 |
tgttgcatttgcgtgttgcctacatgctctg |
11937466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 19 - 74
Target Start/End: Complemental strand, 11953656 - 11953601
Alignment:
| Q |
19 |
cataaagcagttaagagtgtgctgcgaatccagtaattttggttattgatgattgt |
74 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11953656 |
cataaagcagttaagagtgtgctgcaaatccagtaattttggttattgatgattgt |
11953601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University