View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1952_low_71 (Length: 232)
Name: NF1952_low_71
Description: NF1952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1952_low_71 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 226
Target Start/End: Complemental strand, 40320546 - 40320338
Alignment:
| Q |
18 |
actcgatgtcgaagtcttttttgttatcaacctcctccatttcatcttcgtccatttcataatcgtcgggaccagcggattcgacgtcgccgtcgtcggc |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40320546 |
actcgatgtcgaagtctttttcgttatcaacctcctccatttcatcttcgtccatttcataatcgtcgggaccagcggattcgacgtcgccgtcgtcggc |
40320447 |
T |
 |
| Q |
118 |
gcgggttaagaatgggttgcgccgagtggtaggggaggtttggaggatgagaggtttcagtttgaaagaagaggagaataagggttgtggagttctggaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40320446 |
gcgggttaagaatgggttgcgccgagtggtaggggaggtttggaggatgagaggtttgagtttgaaagaagaggagaatgagggttgtggagttctggaa |
40320347 |
T |
 |
| Q |
218 |
agaggtggt |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
40320346 |
agaggtggt |
40320338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University