View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_high_110 (Length: 305)
Name: NF19530_high_110
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_high_110 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 11 - 290
Target Start/End: Original strand, 47803669 - 47803948
Alignment:
| Q |
11 |
atcatcacttgaaaataattgtgtaactctctcgccttgtaaaaccacaaagtaaacatgattaagtgaaggcaaaggttccatcgatacaacttgattt |
110 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
47803669 |
atcatcacttgaaaatgattgtgtaactctctcgccttgcaaaaccacaaagtaaacatgattaagcgaaggcaaaggttccatcaatacaacttgattt |
47803768 |
T |
|
| Q |
111 |
tgtacgagagtattgatcataagtgctaatgaagaactaaatcacttgaccatttaaatgaaattcttttgcattgcacatagataaacatcaacactcc |
210 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47803769 |
tgtacgagggtattgatcataagtgctactgaagaattaaatcacttgaccatttaaatgaaatttttttgcattgcacatagataaacatcaacactcc |
47803868 |
T |
|
| Q |
211 |
tcgaattaaaggtgtcccgtcagcgtgtttgtgtcggtgcttcatggacactgatgatggaaaatgcaatatgatataat |
290 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47803869 |
tcgaattaaaggtgtcccgtcaacgtgtttgtgtcggtgcttcatcgacactgatgatggaaaatgcaatatgatataat |
47803948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University