View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_high_129 (Length: 283)
Name: NF19530_high_129
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_high_129 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 18408045 - 18408195
Alignment:
| Q |
1 |
aacaatgaatagcatatactacaaaagtacatgggacatctcaattatataaagttgggtccccgaatgtgtggttaggaaacaatggtatgcacaatac |
100 |
Q |
| |
|
|||||||| | | ||||||||||||||||||||||||| || ||||||| |||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18408045 |
aacaatgatttgtatatactacaaaagtacatgggacagcttaattata--aagttgggtccctgaatgtgtggtaaggaaacaatggtatgcacaatac |
18408142 |
T |
|
| Q |
101 |
tcttttataaggtacatgtacgtctatattgtctacacactttcgatgtggga |
153 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18408143 |
tcttttataaggtacatgtatgtctatattgtctacacactttcgatgtggga |
18408195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 202 - 265
Target Start/End: Original strand, 18408520 - 18408583
Alignment:
| Q |
202 |
aaaactaactatggctgcaattgcatacaagaattcaacttatatttttcatatggccgtaaac |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18408520 |
aaaactaactatggctgcaattgcatacaagaattcaacttatatttttcatatggccgtaaac |
18408583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 93 - 154
Target Start/End: Original strand, 18429106 - 18429166
Alignment:
| Q |
93 |
cacaatactcttttataaggtacatgtacgtctatattgtctacacactttcgatgtgggac |
154 |
Q |
| |
|
|||||| || ||||||| ||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
18429106 |
cacaatcctgttttata-ggtacatgtttgtctatattgtttacacactttcgatgtgggac |
18429166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 156
Target Start/End: Original strand, 18427185 - 18427231
Alignment:
| Q |
110 |
aggtacatgtacgtctatattgtctacacactttcgatgtgggactt |
156 |
Q |
| |
|
||||||||||| || || |||||||||||||||||||||||||||| |
|
|
| T |
18427185 |
aggtacatgtatgttcatgttgtctacacactttcgatgtgggactt |
18427231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 93 - 154
Target Start/End: Original strand, 18409981 - 18410041
Alignment:
| Q |
93 |
cacaatactcttttataaggtacatgtacgtctatattgtctacacactttcgatgtgggac |
154 |
Q |
| |
|
|||||| || ||||||| ||||||||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
18409981 |
cacaatcctgttttata-ggtacatgtttgtctatgttgtttacacactttcgatgtgggac |
18410041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University