View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_high_132 (Length: 278)
Name: NF19530_high_132
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_high_132 |
 |  |
|
| [»] scaffold0077 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0077 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: scaffold0077
Description:
Target: scaffold0077; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 57 - 266
Target Start/End: Original strand, 9259 - 9468
Alignment:
| Q |
57 |
ctaggctcaactccaattggtcagacacatacatattcacnnnnnnnnnnnnnnggtctgaagacacatacatattataatcggtacaagactaattttg |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9259 |
ctaggctcaactccaattggtcagacacatacatattcacttttttaaatttttggtctgaagacacatacatattataatcggtacaagactgattttg |
9358 |
T |
 |
| Q |
157 |
ttaaaataataatatgaacaaatcacatctcaattctaatattgcgtgagtctaaccaatatcagtttttatctatttcttttcttactccgagctacaa |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9359 |
ttaaaataataatatgaacaaatcacatctcaattctaatattgcgtgagtctaaccaatatcagtttttatctatttcttttcttactccgagctacag |
9458 |
T |
 |
| Q |
257 |
ttcatctcac |
266 |
Q |
| |
|
||||| |||| |
|
|
| T |
9459 |
ttcatttcac |
9468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University