View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_high_133 (Length: 276)
Name: NF19530_high_133
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_high_133 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 9 - 258
Target Start/End: Original strand, 48487483 - 48487732
Alignment:
| Q |
9 |
gattattcttcttctgtgtaccgagaagtacggagtccttgaacttggatggaagcattttaacgcggcctctggatgatagcgacaatggaggtgcatt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
48487483 |
gattattcttcttctgtgtaccgagaagtacggagtccttgaacttggatggaagcattttaacgcggcctctggatgctcgcgacaatggaggtgcatt |
48487582 |
T |
|
| Q |
109 |
ttcagctacaatattcaaatctgtggaagctgaattggagtggatctcgccatcatggaaagagtaaaaggcgttattgagtttgggcttcttctgaatc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48487583 |
ttcagctacaatattcaaatctgtggaagctgaattggagtggatctcgccatcatggaaagagtaaaaggcgttattgagtttgggcttcttctgaatc |
48487682 |
T |
|
| Q |
209 |
tgtagtggagattcttcttctagcttactacatcgcttcaggttctgaat |
258 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48487683 |
tgtggtggagattcttcttctagcttactacatcgcttcagattctgaat |
48487732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University