View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_high_134 (Length: 274)
Name: NF19530_high_134
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_high_134 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 19 - 109
Target Start/End: Original strand, 16763263 - 16763353
Alignment:
| Q |
19 |
ttctcaaaattaaccactgaatttgaacctgaatccatgtcatcaaacacaaaccatgttataattcaactatatgcacacaaatatgtac |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16763263 |
ttctcaaaattaaccactgaatttgaacctgaatccatgtcatcaaacacaaaccatgttataattcaactatatgcacacaaatatgtac |
16763353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 177 - 258
Target Start/End: Original strand, 16763421 - 16763502
Alignment:
| Q |
177 |
atggtttcttcacaatgaaaaaagaaacccactttcatgatcttaagaaacatgtgtgagttatcctctatgatattcataa |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16763421 |
atggtttcttcacaatgaaaaaagaaacccactttcatgatcttaagatacatgtgtgagttatcctctatgatattcataa |
16763502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University