View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_high_141 (Length: 265)
Name: NF19530_high_141
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_high_141 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 4405193 - 4404936
Alignment:
| Q |
1 |
catcaatataaggtggcatttagatgcacacttttaaatgttcgtttggttccacttttttgagatatcaaaattgatattagaagtgttgaattgattt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4405193 |
catcaatctaaggtggcatttagatgcacacttttaaatgctcgtttggttccacttttttgagatatcaaaattgatattagaagtgttgaattgattt |
4405094 |
T |
|
| Q |
101 |
taactttttaaaatattgtggtagaaataattttgtatctaaaatttgaatcatattaaaaactagctggttttcaaattttgactttaaatgattttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4405093 |
taactttttaaaatattgtggtagaaatgattttgtatctaaaatttgaatcatattaaaaactagctggttttcaaattttgactttaaatgattttta |
4404994 |
T |
|
| Q |
201 |
ccttcatagtagcatcatttacctctatttagtctaattgcatgatgatcctttgctt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4404993 |
ccttcatagtagcatcatttacctctatttagtctaattgcatgatgatcctttgctt |
4404936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University