View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_high_159 (Length: 248)
Name: NF19530_high_159
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_high_159 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 4e-56; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 16 - 145
Target Start/End: Original strand, 6255995 - 6256131
Alignment:
| Q |
16 |
actaacattcacttcagttatgcttatgcaacaaacgatgaagtaattttagaacgagtaagttgaaaagattttccaac-------aaatcttaatgaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6255995 |
actaacattcacttcagttatgcttatgcaacaaacgatgaagtaattttagaacgagtaagttgaaaagattttccaacaaatcttaaatcttaatgaa |
6256094 |
T |
|
| Q |
109 |
atgcattttgcaggttatatatctatcaagtgcccct |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6256095 |
atgcattttgcaggttatatatctatcaagtgcccct |
6256131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 172 - 232
Target Start/End: Original strand, 6256189 - 6256249
Alignment:
| Q |
172 |
atatatttcacatgctaaatattgtttcaaacgccaaattttggcagtagaaggtgttgta |
232 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6256189 |
atatatttcaaatgctaaatattgtttcaaacgccaaattttggcagtagaaggtgttgta |
6256249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 66
Target Start/End: Original strand, 6228551 - 6228599
Alignment:
| Q |
16 |
actaacattcacttcagttatgcttatgcaacaaacgatgaagtaatttta |
66 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||||||||||||||| |
|
|
| T |
6228551 |
actaacattcacttaagttatgcgtatgcaacaa--gatgaagtaatttta |
6228599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 22 - 69
Target Start/End: Original strand, 6274780 - 6274827
Alignment:
| Q |
22 |
attcacttcagttatgcttatgcaacaaacgatgaagtaattttagaa |
69 |
Q |
| |
|
||||||| || ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
6274780 |
attcactccacttacgcttatgcatcaaacgatgaagtaattttagaa |
6274827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University