View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_high_166 (Length: 240)
Name: NF19530_high_166
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_high_166 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 13393773 - 13393551
Alignment:
| Q |
1 |
ttactaacatttgcatataaaaagacatcgttatnnnnnnnnnttgtacctcggaacgtgtggcttcggctatgagacacaagatgaagcaaagtaagcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13393773 |
ttactaacatttgcatataaaaagacatcgttattaaaaaaaattgtacctcggaacgtgtggcttcggctatgagacacaggatgaagcaaagtaagcc |
13393674 |
T |
 |
| Q |
101 |
taatagaattgtgaaaaccataagaaaagctcctgttttgctactcaaatctgttttacttctttttggttcaaggtctgcatgtgtaactgccattctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13393673 |
taatagaattgtgaaaaccataagaaaagctcctgttttgctactcaaatctgttttacttctttttggttcaaggtctgcatgtgtaactgccattctc |
13393574 |
T |
 |
| Q |
201 |
tatgacccttcaagagagacaat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13393573 |
tatgacccttcaagagagacaat |
13393551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 95 - 201
Target Start/End: Complemental strand, 13396674 - 13396574
Alignment:
| Q |
95 |
taagcctaatagaattgtgaaaaccataagaaaagctcctgttttgctactcaaatctgttttacttctttttggttcaaggtctgcatgtgtaactgcc |
194 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||| || ||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
13396674 |
taagcctaatataattgtgataac---aagaaaaactactgttttactactcaaatctgttttactt---tttggttcaaggtctgcatgtgtaacagcc |
13396581 |
T |
 |
| Q |
195 |
attctct |
201 |
Q |
| |
|
||||||| |
|
|
| T |
13396580 |
attctct |
13396574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University