View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19530_high_168 (Length: 240)

Name: NF19530_high_168
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19530_high_168
NF19530_high_168
[»] chr3 (1 HSPs)
chr3 (12-224)||(49369660-49369872)


Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 12 - 224
Target Start/End: Complemental strand, 49369872 - 49369660
Alignment:
12 atgaataaatttccaagaaaaatccctttggagttttgtggaattgaggggtgtacaaagtggcagacatttatcagtatattacctgatcttgcttgga 111  Q
    ||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||    
49369872 atgaataaatttcgaagaaaaatccctttggagttttctggaattgaggggtgtacaaaatggcagacatttatcagtatattacctgatcttgcatgga 49369773  T
112 cttcgtaatggatagaagcggacaagttagaacccttttgatcagccctttcagttccctagcactattttttcagactgtttctcaattccctcctata 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||    
49369772 cttcgtaatggatagaagcggacaagttagaacccttttgatcagccctttcagttccctagcactattttttcagactgtttctcaattcccaactata 49369673  T
212 tgcttgcttaagt 224  Q
    |||||||||||||    
49369672 tgcttgcttaagt 49369660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University