View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_high_169 (Length: 238)
Name: NF19530_high_169
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_high_169 |
 | |
|
| [»] scaffold0041 (1 HSPs) |
| |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0041 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 81149 - 81367
Alignment:
| Q |
18 |
aggttgagacatatgaggcacacaaacgcgctagatataatactaatattgactcgtaaacacttataataaaattgattatatgcaatcacatgtagcg |
117 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||| | ||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
81149 |
aggttgagatatatgaggcaca--aacgcgctagatataatactaacactgactcgtaaacatttataataaaattgattatatgtaatcacatgtagcg |
81246 |
T |
|
| Q |
118 |
gtatcagatgctagttcatgtttgacacaaaatacataatctatccgaagagggcattgcaaagaggaattataggcaaccgttctaatcaaggtggtga |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
81247 |
gtgtcagatgctagttcatgtttgacacaaaatacataatctatccgaagagggcattgcaaagaggaattataggcaaccgttctaatcaaggtggtga |
81346 |
T |
|
| Q |
218 |
atatacccttttgattccttc |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
81347 |
atatacccttttgattccttc |
81367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 40885135 - 40884917
Alignment:
| Q |
18 |
aggttgagacatatgaggcacacaaacgcgctagatataatactaatattgactcgtaaacacttataataaaattgattatatgcaatcacatgtagcg |
117 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||| | ||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40885135 |
aggttgagatatatgaggcaca--aacgcgctagatataatactaacactgactcgtaaacatttataataaaattgattatatgtaatcacatgtagcg |
40885038 |
T |
|
| Q |
118 |
gtatcagatgctagttcatgtttgacacaaaatacataatctatccgaagagggcattgcaaagaggaattataggcaaccgttctaatcaaggtggtga |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40885037 |
gtgtcagatgctagttcatgtttgacacaaaatacataatctatccgaagagggcattgcaaagaggaattataggcaaccgttctaatcaaggtggtga |
40884938 |
T |
|
| Q |
218 |
atatacccttttgattccttc |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40884937 |
atatacccttttgattccttc |
40884917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University