View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_high_181 (Length: 235)
Name: NF19530_high_181
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_high_181 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 15 - 216
Target Start/End: Original strand, 42340840 - 42341041
Alignment:
| Q |
15 |
gtgagatgaattggcaacaaggggaggtagaatcattgcagagggaaggagaagaagcgaccaggaatgacgtcaacaatgtcatttcttcatcgctcgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42340840 |
gtgagatgaattggcaacaaggggaggtagaatcattgcaaagggaaggagaagaagcgatcaggaatgacgtcaacaatgtcatttcttcatcgctcgg |
42340939 |
T |
 |
| Q |
115 |
aaggcaatcgtcatccatatactcactcacccttgacgagttccaacacagcctctgtgatagcggcaagaatttcggatccatgaacatggatgagttt |
214 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42340940 |
aaggcaatcttcatccatatactcactcaccctcgacgagttccaacacagcctctgtgatagcggcaagaatttcggatccatgaacatggatgagttt |
42341039 |
T |
 |
| Q |
215 |
ct |
216 |
Q |
| |
|
|| |
|
|
| T |
42341040 |
ct |
42341041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University