View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_high_185 (Length: 229)
Name: NF19530_high_185
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_high_185 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 13 - 229
Target Start/End: Complemental strand, 3810646 - 3810430
Alignment:
| Q |
13 |
cagaatcacaacttaattgagtaggtatcccatcttggttatatagcatatctttcttcttgtgaggagttttgtacctgtttgatcccttattcttcat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810646 |
cagaatcacaacttaattgagtaggtatcccatcttggttatatagcatatctttcttcttgtgaggagttttgtacctgtttgatcccttattcttcat |
3810547 |
T |
 |
| Q |
113 |
tatttcaaccatgcatgtttgtagagtataaaattttttatcggattgtacacatgaatattcatcaaatgctttctgaactgcatgaataagatcatca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3810546 |
tatttcaaccatgcatgtttgtagagtataaatttttttatcggattgtacacatgaatattcatcgaatgctttctgaactgcatgaataagatcatca |
3810447 |
T |
 |
| Q |
213 |
attgacttcattgattc |
229 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3810446 |
attgacttcattgattc |
3810430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University