View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_high_191 (Length: 221)
Name: NF19530_high_191
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_high_191 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 208
Target Start/End: Original strand, 39537200 - 39537388
Alignment:
| Q |
20 |
aaagtaacaatgctttgctgtctttttggtattttactgtgcaaatcgcccttcaaatttttgctgtctactgaggtagtttacccatctttgtaaattt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39537200 |
aaagtaacaatgctttgctgtctttttggtattttactgtgcaaattgcccttcaaatttttgctgtctactgaggtagtttacctatctttgtaaattt |
39537299 |
T |
 |
| Q |
120 |
cgctgttttggtttttagttttggctcatacaaaggctattgttcaaccctctttcaatttttcgtcacttttcttaactttctctgct |
208 |
Q |
| |
|
| ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39537300 |
ccttgttttggttttttgttttggctcatacaaaggctattgttcaactctctttcaatttttcgtcacttttcttaactttctctgct |
39537388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University