View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_high_197 (Length: 214)
Name: NF19530_high_197
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_high_197 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 4 - 209
Target Start/End: Original strand, 47905102 - 47905309
Alignment:
| Q |
4 |
gggaaacaaattggatttttgtgtttcatgaagatgcaggaaggtaagaaaatggttcatgtgtttcataatgttatgtttggaacatacaaaacagagg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
47905102 |
gggaaacaaattggatttttgtgtttcatgaagatgcaggaaggtaagaaaatggttcatgtgtttcatgatgttatgtttggaacatggaaaacagagg |
47905201 |
T |
 |
| Q |
104 |
caaggctgcaaaatcaggatgaagttgttggtatgatgaatgatataatgtcatggaaca--atgtcatattttttgtatgcatggtgtgcatgatgcct |
201 |
Q |
| |
|
| ||| |||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47905202 |
cgaggttgcaaagtcaggatgaagttgttggtatgatgaatgatataaagtcatggaacaatatgtcatattttttgtatgcatggtgtgcatgatgtct |
47905301 |
T |
 |
| Q |
202 |
atgcttct |
209 |
Q |
| |
|
||| |||| |
|
|
| T |
47905302 |
atggttct |
47905309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University