View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_high_64 (Length: 401)
Name: NF19530_high_64
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_high_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 18 - 386
Target Start/End: Original strand, 29624613 - 29624979
Alignment:
| Q |
18 |
aggtgagttgctgaaagagaccttggaacgtgatttgtagaagagggagaggttggaatttcctttcatgtttagatttgtggttggtgccctttaaaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29624613 |
aggtgagttgctgaaagagaccttggaacgtgatttgcagaagagagaggggttggaatttcctttcatgtttagatttgtggctggtgccctttaaaat |
29624712 |
T |
 |
| Q |
118 |
gcaaccatcacatcacatgttctgaaatttccttagcagtcaataaggtttgccagttcatggccaatcgcttagattctcatcggatggcagtcaaacg |
217 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29624713 |
gcaaccatcacatcacatgtcctgaaatttccttagcagtcaataaggtttgccagttcatggccaatcgcttggattctcatcggatggcagtcaaacg |
29624812 |
T |
 |
| Q |
218 |
catcatacactatctgaaaggcactatgcatcttggcctttgtgccactcttgccctagttaacagacaaccatctctcagaccctttttgtgatgttga |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29624813 |
catcatacactatctgaaaggcactatgcatcttggcctttgtgccactcttgccctagttaacagacaaccatctctcagaccc--tttgtgatgttga |
29624910 |
T |
 |
| Q |
318 |
ctgggcaattgaccctgatgacaggtgctcaaccaatggtgctgcaacttattttgggcccaatttgat |
386 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29624911 |
ctgggcaattgaccctgatgacaggtgctcaaccaatggtgctgcaacttattttgggcccaatttgat |
29624979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University