View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_high_79 (Length: 366)
Name: NF19530_high_79
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_high_79 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 13 - 171
Target Start/End: Original strand, 23056934 - 23057092
Alignment:
| Q |
13 |
cagagaagaaaaggaggcaaggtggttggagaagatgaggtggggtggtgaggatggaagagtttgagtagattcgatggtgggggtgaacgacggtggt |
112 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
23056934 |
cagagaagaaaaggaggcaaggtggtcggagaagatgaggtggggtggtgaggatggaaaaatttgagtagatccggtggtgggggtgaacgacggtggt |
23057033 |
T |
 |
| Q |
113 |
gaggagaaggatgggtgatgatggtgtttgattcagtgggtatggtggccagtgagggt |
171 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||| |||||||| ||||||| |
|
|
| T |
23057034 |
gaggagaaggatgagtgatgatggtgtttgattcggtgggtacggtggccaatgagggt |
23057092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 248 - 352
Target Start/End: Original strand, 23057169 - 23057273
Alignment:
| Q |
248 |
ttgttgagtgtttgtgtcaacaacatatttagaaatttcaacttgagagggcaagatcatgtacacacaaactcaagataaaatgatgatattgttatct |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23057169 |
ttgttgagtgtttgtgtcaacaacatatttagaaatttcaacttgagagggcaagatcatttatacacaaactcaagataaaatgatgatatcgttatct |
23057268 |
T |
 |
| Q |
348 |
ttgac |
352 |
Q |
| |
|
||||| |
|
|
| T |
23057269 |
ttgac |
23057273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 9e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 34 - 132
Target Start/End: Complemental strand, 38336909 - 38336812
Alignment:
| Q |
34 |
gtggttggagaagatgaggtggggtggtgaggatggaagagtttgagtagattcgatggtgggggtgaacgacggtggtgaggagaaggatgggtgatg |
132 |
Q |
| |
|
|||||| || || ||||||||||||||||| |||||| ||||||||| ||||||||||||| |||||| ||||||||| ||||||||||||||||| |
|
|
| T |
38336909 |
gtggttagaaaatatgaggtggggtggtgatgatggattgatttgagtagtttcgatggtgggg-tgaacggcggtggtgaagagaaggatgggtgatg |
38336812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University