View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_high_84 (Length: 357)
Name: NF19530_high_84
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_high_84 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 351
Target Start/End: Complemental strand, 42805175 - 42804825
Alignment:
| Q |
1 |
ttactacattaaagtttaatttgacttttctccctatatatcctgcatggcctacttgatcaagacgaaggtgctattcagttaataggcttcccttccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42805175 |
ttactacattaaagtttaatttgacttttctccctatatatcctccatggcctacttgatcaagacgaaggtgctattcagttaataggcttcccttccc |
42805076 |
T |
 |
| Q |
101 |
acgtaagcatatgcgctgacaatggcaagaaatcaggatgccacctaaagttgtaaacnnnnnnnttgaatgtaatttgatgggattttgaagtgaagga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42805075 |
acgtaagcatatgcgctgacaatggcaagaaatcaggatgccacctaaagttgtaaacaaaaaaattgaatgtaatttgatgggattttgaagtgaagga |
42804976 |
T |
 |
| Q |
201 |
aagtaaaagtgagtatgagatgcttttttcaatttggagtaagtgtcaaaccttcctttcatggaggcttgctatgagtagaaggaagaccaagtaggat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42804975 |
aagtaaaagtgagtatgagatgcttttttcaatttggagtaagtgtgaaaccttcctttcatggaggcttgctatgagtagaaggaagaccaagtaggat |
42804876 |
T |
 |
| Q |
301 |
aggggcaatgggaccttatagaagggccattaccattagtatattcttcga |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42804875 |
aggggcaatgggaccttatagaagggccattaccattagtattttcttcga |
42804825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University