View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_low_101 (Length: 324)
Name: NF19530_low_101
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_low_101 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 15 - 324
Target Start/End: Original strand, 48487196 - 48487505
Alignment:
| Q |
15 |
aatatcacccaaatgaaaatccactagtttgaaaatctctttcccttttttacccttttcatcaaaacaatttccactctccactttaaccaataacata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48487196 |
aatatcacccaaatgaaaatccactagtttgaaaatctctttcccttttttacccttttcatcaaaacaatttccactctccgctttaaccaataacatt |
48487295 |
T |
 |
| Q |
115 |
cgactccctttaaccgtctttttaatgctcttaaacgacttagcatgcttctcataatcaaattcatcaaaaccattatcactctcttttttcggatcgc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48487296 |
cgactccctttaaccgtctttttaatgctcttaaacgacttagcatgcttctcataatcaaattcatcaaaaccattatcactctcttttttcggatcgc |
48487395 |
T |
 |
| Q |
215 |
gtttgttttcctttcccttatttacaaatctaattccagtgtcactactctcaccttcaaaactgagcttggagttttgtatttgtcgattattcttctt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48487396 |
atttgttttcctttcccttatttacaaatctaattacagtatcactactctcaccttcaaaactgagcttggagttttgtatttgtcgattattcttctt |
48487495 |
T |
 |
| Q |
315 |
ctgtgtaccg |
324 |
Q |
| |
|
|||||||||| |
|
|
| T |
48487496 |
ctgtgtaccg |
48487505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University