View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_low_122 (Length: 294)
Name: NF19530_low_122
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_low_122 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 17 - 251
Target Start/End: Original strand, 30001705 - 30001937
Alignment:
| Q |
17 |
caaaaacaaggtggcttgtaaatgtggaacatgaggtaatgttgagagaaaatctccggcaaggtctaccatccttttaacccccaaattgactattgta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30001705 |
caaaaacaaggtggcttgtaaatgtggatcatgaggtaatgttgaaagaaaatctccggcaaggtctaccatccttttaacccccaaattgactattgca |
30001804 |
T |
|
| Q |
117 |
tattcatgatgtcacttaaatatgtgggtttgagacactatnnnnnnnccactatttaatgtgtctagaagaaaaaggatgcagtgttctttggagaagt |
216 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
30001805 |
tattcatgatgtcatttaaatatgtgggtttgagacaccataataaaaccactatttaatgtgtctagaataaaaaggatgcagtgttctttggagaggt |
30001904 |
T |
|
| Q |
217 |
acttgaaccctctctgcttaaatcctttttatata |
251 |
Q |
| |
|
||| ||||||||||| |||||||||||||||||| |
|
|
| T |
30001905 |
actcgaaccctctct--ttaaatcctttttatata |
30001937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University