View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_low_126 (Length: 290)
Name: NF19530_low_126
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_low_126 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 30593591 - 30593853
Alignment:
| Q |
1 |
aaacaacaacctccatgacttaaacgagtcgcttcaaactgaaagaaactagagacagattgttcgttcctgcgtgcgtaagttattattttgttccgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30593591 |
aaacaacaacctccatgacttaaacgagtcgcttcaaactgaaagaaactagagacagattgttcgttcctgcgtgcgtaag---ttattttgttccgga |
30593687 |
T |
|
| Q |
101 |
tatggttgttagtggttacgcggtctaagg--------ttgtcttatgaaattgggttttgctaattctcaattaacaaattatttattggaaattttaa |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30593688 |
tatggttgttagtggttacgcggtctaaggttgtctacttgtcttgtgaaattgggttttgctaattctcaattaacaaattatttattggaaattttaa |
30593787 |
T |
|
| Q |
193 |
tacttgatgcattcaaggcacaatttctatnnnnnnnnttactttttaaagtctttaaaaaatatct |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30593788 |
tacttgatgcattcaaggcacaatttctat-aaaaaaattactttttaaagtctttaaaaaatatct |
30593853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University