View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_low_149 (Length: 258)
Name: NF19530_low_149
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_low_149 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 16 - 245
Target Start/End: Original strand, 6351165 - 6351394
Alignment:
| Q |
16 |
cagcagtatcgaaagcaagaaccccggaatacaagaagcaaggcaggtgagcataaagataagtgttggtatttagtctctctctgtaactatatttttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6351165 |
cagcagtatcgaaagcaagaaccccggcatacaagaagcaaggcaggtgagcataaagataagtgttggtatttagtctctctctgtaactatatttttg |
6351264 |
T |
 |
| Q |
116 |
ttatgttttttcagagctgaatgtgatctaaatttttaattcttctcaaatgataatatttttaaattgtatattcaaagagcaggtaatgttcgaccag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6351265 |
ttatgttttttcagagctgaatgtgatctaaatttttaattcttctcaaatgataatatttttaaattgtatattcaaagagcaagtaatgttcgaccag |
6351364 |
T |
 |
| Q |
216 |
tctcaactctcaactatctgcatttgtttc |
245 |
Q |
| |
|
||||||||||||||||||||| |||||||| |
|
|
| T |
6351365 |
tctcaactctcaactatctgcctttgtttc |
6351394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University