View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_low_165 (Length: 248)
Name: NF19530_low_165
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_low_165 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 40181725 - 40181962
Alignment:
| Q |
1 |
agaagcattactaagaagactcatcactttctggaaatctttggaggcggtgatgacgttgtcgtcgttgtcacgatatgtaaacgagggattacatgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40181725 |
agaagcattactaagaagactcatcactttctgtaaatctttggaggcggtgatgacgttgtcgtcgttgtcacgatatgtaaacgagggattacatgaa |
40181824 |
T |
 |
| Q |
101 |
gtggatgatgatgatgattgacttagaaagttggagaaaatgaccttgttagggttaggaattcttcgtgtggatgatgatgaggaggaag------aag |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
40181825 |
gtggatgatgatgatgattgacttagaaagttggagaaaatgaccttgttagggttaggaattcttcgtgtggatgatgataaggaggaagaagaagaag |
40181924 |
T |
 |
| Q |
195 |
aagaagtgatgtagttcctgccatatcttgctgcaaac |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40181925 |
aagaagtgatgtagttcctgccatatcttgctgcaaac |
40181962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 39
Target Start/End: Original strand, 38606229 - 38606264
Alignment:
| Q |
4 |
agcattactaagaagactcatcactttctggaaatc |
39 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38606229 |
agcattactaagaagactcatcactttatggaaatc |
38606264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 39
Target Start/End: Complemental strand, 44459176 - 44459145
Alignment:
| Q |
8 |
ttactaagaagactcatcactttctggaaatc |
39 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44459176 |
ttactaagaagactcatcactttctggaaatc |
44459145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 39
Target Start/End: Complemental strand, 44466709 - 44466678
Alignment:
| Q |
8 |
ttactaagaagactcatcactttctggaaatc |
39 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44466709 |
ttactaagaagactcatcactttctggaaatc |
44466678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University