View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_low_168 (Length: 243)
Name: NF19530_low_168
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_low_168 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 1445568 - 1445720
Alignment:
| Q |
1 |
tttaataagggcattctagtcattagaaacattaaccgctcaactagtttgttcggtctctatacccttgacgtggctgttttctcttttgtgagaaact |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1445568 |
tttaataagggtattctagtcattagaaacattaaccgctcaactagtttgttcggtctctatacccttgacgtggctgttttctcttttgtgagaaact |
1445667 |
T |
|
| Q |
101 |
ctttacgtggcttacatcaatatcaatacaaattttagctttttaagagaaaa |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1445668 |
ctttacgtggcttacatcaatatcaatacaaattttagctttttaagagaaaa |
1445720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 152 - 228
Target Start/End: Original strand, 1446126 - 1446202
Alignment:
| Q |
152 |
aaataatatactgtatgcttttattttctatgaaataccttatcagaagtaattttacaaaagtctcatgcatgttt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1446126 |
aaataatatactgtatgcttttattttctatgaaattccttatcagaagtaattttactaaagtctcatgcatgttt |
1446202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University