View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_low_173 (Length: 240)
Name: NF19530_low_173
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_low_173 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 12 - 224
Target Start/End: Complemental strand, 49369872 - 49369660
Alignment:
| Q |
12 |
atgaataaatttccaagaaaaatccctttggagttttgtggaattgaggggtgtacaaagtggcagacatttatcagtatattacctgatcttgcttgga |
111 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49369872 |
atgaataaatttcgaagaaaaatccctttggagttttctggaattgaggggtgtacaaaatggcagacatttatcagtatattacctgatcttgcatgga |
49369773 |
T |
 |
| Q |
112 |
cttcgtaatggatagaagcggacaagttagaacccttttgatcagccctttcagttccctagcactattttttcagactgtttctcaattccctcctata |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49369772 |
cttcgtaatggatagaagcggacaagttagaacccttttgatcagccctttcagttccctagcactattttttcagactgtttctcaattcccaactata |
49369673 |
T |
 |
| Q |
212 |
tgcttgcttaagt |
224 |
Q |
| |
|
||||||||||||| |
|
|
| T |
49369672 |
tgcttgcttaagt |
49369660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University