View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_low_182 (Length: 236)
Name: NF19530_low_182
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_low_182 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 13918014 - 13917794
Alignment:
| Q |
1 |
acaaacttgaagaaaaagatgcttaaaatgggattaggatgcttaaaataggataccaagatcctatatggctcaagcaaaatgggactaaaacatcgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13918014 |
acaaacttgaagaaaaagatgcttaaaatgggattaggatgcttaaaataggataccaagatcctatatggctcaagcaaaataggactaaaacatcgat |
13917915 |
T |
|
| Q |
101 |
agtgagggcgcatatagaaccatgagaccaaacagtgaccaaagaggaggcttcacggtgaccggagacgatgtgccagatctagggaggtgaggctttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13917914 |
agtgagggcgcatatagaaccatgagaccaaacagtgaccaaagaggaggcttcacggtgaccggagacgatgtgccagatctagggaggtgaggctttt |
13917815 |
T |
|
| Q |
201 |
ggtggagtgacattgtcaaaa |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
13917814 |
ggtggagtgacattgtcaaaa |
13917794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University