View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_low_184 (Length: 236)
Name: NF19530_low_184
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_low_184 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 5 - 136
Target Start/End: Complemental strand, 50237083 - 50236952
Alignment:
| Q |
5 |
gatttgtattattatatcatacataatgtttgtttctttcaacaatcatcacgtgccaattcttaattttaggttgataagggttatattgagcgaaatt |
104 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50237083 |
gattggtattattatatcatacataatgtttgtttctttcaacaatcatcatgtgccaattcttaattttaggttgataagggttatattgagcgaaatt |
50236984 |
T |
|
| Q |
105 |
tcattaattaggttagtactgctgtttgattt |
136 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |
|
|
| T |
50236983 |
tcattaattaggttagtactgctggttgattt |
50236952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 162 - 221
Target Start/End: Complemental strand, 50236937 - 50236878
Alignment:
| Q |
162 |
gggtatgtgtcaagatggatgaggtgctgtcatcggttgcagagacaataaagaactttg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50236937 |
gggtatgtgtcaagatggatgaggtgctgtcatcggttgcagagacaataaagaactttg |
50236878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 165 - 221
Target Start/End: Complemental strand, 17278930 - 17278874
Alignment:
| Q |
165 |
tatgtgtcaagatggatgaggtgctgtcatcggttgcagagacaataaagaactttg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17278930 |
tatgtgtcaagatggatgaggtgctgtcatcggttgcagagacaataaagaactttg |
17278874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University