View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_low_185 (Length: 236)
Name: NF19530_low_185
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_low_185 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 92 - 228
Target Start/End: Complemental strand, 50188581 - 50188443
Alignment:
| Q |
92 |
caagcggcagttttgcatttaaaataagaataagaaacattttctcaaagcaatgc--gagtatagatccacgcaggttggttacgcggtaggcctgtac |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
50188581 |
caagcggcagttttgcatttaaaataagaataagaaacattttctcaaagcaatgcacgagtatagatccacgcaggttggttatgcggtaggccggtac |
50188482 |
T |
 |
| Q |
190 |
ttcaaaaccccaacgaaactctagcattgattgatgatg |
228 |
Q |
| |
|
|| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50188481 |
ttaaaaacccccacgaaactctagcattgattgatgatg |
50188443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 50188672 - 50188617
Alignment:
| Q |
1 |
tgtttttagattatttatattggtgaaatcattttttgtgttttctctattttctg |
56 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50188672 |
tgtttttaaattatttatattggtgaaatcattttttgtgttttctctattttctg |
50188617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University