View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_low_189 (Length: 231)
Name: NF19530_low_189
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_low_189 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 17 - 159
Target Start/End: Original strand, 27208538 - 27208680
Alignment:
| Q |
17 |
atgcataattcacaccaggtgtgactgaggaagaggcaccgccgccgtcaccggagaaagggatgcaaggtcgccggagactgagacgagctagagagta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27208538 |
atgcataattcacaccaggtgtgactgaggaagaggcaccgccgccgtcaccggagaaagggatgcaaggtcgccgcagactgagacgagctagagagtg |
27208637 |
T |
|
| Q |
117 |
tgaaactgaatttgcattggggtattactcaagattcgtatac |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27208638 |
tgaaactgaatttgcattggggtattactcaagattcctatac |
27208680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University