View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19530_low_196 (Length: 221)

Name: NF19530_low_196
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19530_low_196
NF19530_low_196
[»] chr8 (1 HSPs)
chr8 (20-208)||(39537200-39537388)


Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 208
Target Start/End: Original strand, 39537200 - 39537388
Alignment:
20 aaagtaacaatgctttgctgtctttttggtattttactgtgcaaatcgcccttcaaatttttgctgtctactgaggtagtttacccatctttgtaaattt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||    
39537200 aaagtaacaatgctttgctgtctttttggtattttactgtgcaaattgcccttcaaatttttgctgtctactgaggtagtttacctatctttgtaaattt 39537299  T
120 cgctgttttggtttttagttttggctcatacaaaggctattgttcaaccctctttcaatttttcgtcacttttcttaactttctctgct 208  Q
    |  ||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
39537300 ccttgttttggttttttgttttggctcatacaaaggctattgttcaactctctttcaatttttcgtcacttttcttaactttctctgct 39537388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University