View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_low_197 (Length: 221)
Name: NF19530_low_197
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_low_197 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 205
Target Start/End: Complemental strand, 9028340 - 9028150
Alignment:
| Q |
14 |
caaaggccaaactaaaatcaaactaacaccaagctttatttacttgttctatatttttagtatttttcactctgaatggtctgtttagatggcttattta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9028340 |
caaaggccaaactaaaatcaaactaacaccaagctttatttacttgttctatatttttagtatttttcactctgaatggtctgtttagat-gcttattta |
9028242 |
T |
 |
| Q |
114 |
atcttatgtactaacatcaagcacttgtgaactattttggagaatttagaaaagaagcttatgatatattcataagccgttttcaacttatt |
205 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9028241 |
atcttatgcactaacatcaagcacttgtgaactattttgaagaatttagaaaagcagcttatgatatattcataagccgttttcaacttatt |
9028150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 205
Target Start/End: Complemental strand, 34290338 - 34290276
Alignment:
| Q |
143 |
aactattttggagaatttagaaaagaagcttatgatatattcataagccgttttcaacttatt |
205 |
Q |
| |
|
|||||||| |||||||||| ||| |||||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
34290338 |
aactatttgggagaatttattaaaaaagcttatgacatattcataagttgttttcagcttatt |
34290276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University