View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_low_198 (Length: 219)
Name: NF19530_low_198
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_low_198 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 42960928 - 42961116
Alignment:
| Q |
1 |
taactgatttcttaagaggaacaaaaattgtgttcattgggttatcagccatacccttcccaacaaatctgttgtcaagtaccacagggattttcaagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42960928 |
taactgatttcttaagaggaacaaaaattgtgttcattggattatcagccatacccttcccaacaaatctgttgtcaagtaccacagggattttcaagtt |
42961027 |
T |
 |
| Q |
101 |
ctcaagttctgcttttgggccaattccactgagtaatagcatttgaggagttccaattgccccactagacacaatcacttcactctccc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42961028 |
ctcaagttctgcttttgggccaattccactgagtaatagcatttgaggagttccaattgccccactagacacaatcacttcactctccc |
42961116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 17 - 184
Target Start/End: Complemental strand, 5503759 - 5503592
Alignment:
| Q |
17 |
aggaacaaaaattgtgttcattgggttatcagccatacccttcccaacaaatctgttgtcaagtaccacagggattttcaagttctcaagttctgctttt |
116 |
Q |
| |
|
||||||||||| ||||||||| || ||||| ||| |||||||||||||| |||| ||| ||||| | ||| |||||||||| |||||| |||| |
|
|
| T |
5503759 |
aggaacaaaaactgtgttcataggattatctatcattcccttcccaacaaaaggattgttaaggaccactgagatgttcaagttctgaagttcatcttta |
5503660 |
T |
 |
| Q |
117 |
gggccaattccactgagtaatagcatttgaggagttccaattgccccactagacacaatcacttcact |
184 |
Q |
| |
|
|| ||||||||||| || |||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
5503659 |
ggaccaattccacttagcaatagcatttgaggagacccaattgccccactagacaatatcacttcact |
5503592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University