View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_low_199 (Length: 219)
Name: NF19530_low_199
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_low_199 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 12 - 210
Target Start/End: Complemental strand, 53614494 - 53614296
Alignment:
| Q |
12 |
caaatctctcacagcggataactatttcgggtattattgatgatgagtggtttcaaacagattataagcctatttgtgcatatgaatttgatccgatcat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
53614494 |
caaatctctcacagcggataactatttcgggtattattgatgatgagtggtttcaaacagattataagcctatttgtgcgtatgaatttgatccgatcat |
53614395 |
T |
 |
| Q |
112 |
taacttggatgatgatagttgtgctttcaattcaattgaggtaatttgttaccaaatagtagtcatagaaaacactcaattggagttatgaaacaaatt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
53614394 |
taacttggatgatgatagttgtgctttcaattcaattgaggtaatttgctaccaaatagcagtcatagaaaacactcaattggagttatgaaccaaatt |
53614296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University