View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_low_65 (Length: 403)
Name: NF19530_low_65
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_low_65 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 5e-75; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 113 - 267
Target Start/End: Complemental strand, 3155527 - 3155373
Alignment:
| Q |
113 |
ctattctcctctcaaagaatttggttttctactttagcctccattgtttgatctttttagttttaatttatagactctagctaaatcaggatttccattg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3155527 |
ctattctcctctcaaagaatttggttttctactttagcctccattgtttgatctttttagtttcaatttatagactctagctaaatcaggatttccattg |
3155428 |
T |
|
| Q |
213 |
gattgatttgtaaattggatttgttgttgatttggttccgaatttggaacttgaa |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
3155427 |
gattgatttgtaaattggatttgttgttgatttggttccgaaatttgaacttgaa |
3155373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 265 - 298
Target Start/End: Complemental strand, 3155360 - 3155327
Alignment:
| Q |
265 |
gaaacaagaggttcaccttttttattaagtgtaa |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
3155360 |
gaaacaagaggttcaccttttttattaagtgtaa |
3155327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University